Een colorimetrische assaykit op basis van nanocellulose voor smartphone-detectie van ijzer en ijzerchelaat deferoxamine in biovloeistoffen.

Het huidige werk beschrijft de ontwikkeling van een “op nanopapier gebaseerd analytisch apparaat (NAD)”, door het inbedden van curcumine in transparant bacterieel cellulose (BC) nanopapier, als een colorimetrische testkit voor het monitoren van ijzer en deferoxamine (DFO) als ijzer- chelaatvormer in biologische vloeistoffen zoals serumbloed, urine en speeksel. De ijzerdetectiestrategie met behulp van de ontwikkelde testkit is gebaseerd op de afname van de absorptie / kleurintensiteit van curcumine ingebed in BC-nanopapier (CEBC) in aanwezigheid van Fe (III), als gevolg van de vorming van Fe (III) -curcumine complex.

Aan de andere kant, het vrijkomen van Fe (III) uit Fe (III) -CEBC na toevoeging van DFO als een ijzerchelerend medicijn, vanwege de hoge affiniteit van dit medicijn voor Fe (III) in competitie met curcumine, wat leidt tot herstel van de verminderde absorptie / kleurintensiteit van Fe (III) -CEBC, wordt gebruikt voor selectieve colorimetrische monitoring van dit medicijn. De absorptie / kleurveranderingen van de gefabriceerde assaykit als uitgangssignaal kunnen worden bewaakt met een smartphonecamera of met een spectrofotometer. De resultaten van onze ontwikkelde sensor kwamen goed overeen met de resultaten van een klinische referentiemethode voor het bepalen van de Fe (III) -concentratie in bloedmonsters van menselijk serum, die de klinische toepasbaarheid van onze ontwikkelde assaykit aan het licht brachten.

Alles bij elkaar genomen, met betrekking tot de voordelige eigenschappen van de ontwikkelde sensor als een gebruiksvriendelijke, niet-giftige, wegwerpbare, kosteneffectieve en draagbare testkit, samen met die van smartphone-gebaseerde detectie, wordt verwacht dat dit detecterende bioplatform, die we lab-on-nanopapier noemen, zal bruikbaar zijn voor gevoelige, selectieve en gemakkelijke diagnose van ijzergerelateerde ziekten (ijzerdeficiëntie en ijzerstapeling) en therapeutische drug monitoring (TDM) van ijzerchelerende geneesmiddelen ook in klinische analyse.

GABA enzymatische testkit

We hebben een enzymatisch testsysteem ontwikkeld dat gemakkelijke kwantificering van 4-aminoboterzuur (GABA) mogelijk maakt. De reactie van GABA-aminotransferase verkregen uit Streptomyces decoyicus NBRC 13977 werd gecombineerd met die van het eerder ontwikkelde glutamaattestsysteem met behulp van glutamaatoxidase en peroxidase. Het systeem met drie enzymen dat GABA-afhankelijke kleurstofvorming mogelijk maakt dankzij de oxidatieve koppeling tussen 4-aminoantipyrine en Trinder’s reagens, maakte een nauwkeurige kwantificering van 0,2 – 150 mg / L GABA mogelijk.

Een voorbehandelingsmengsel bestaande uit glutamaatoxidase, ascorbaatoxidase en catalase die respectievelijk glutamaat, ascorbaat en waterstofperoxide elimineren, werd ook bereid om die remmende stoffen uit monsters te verwijderen. Zo werd een geconstrueerde testkit gebruikt om het GABA-gehalte in tomatenmonsters te meten. De resultaten waren bijna hetzelfde als die verkregen met de conventionele methode met behulp van vloeistofchromatografie-tandem-massaspectrometrie. De kit zal een veelbelovend hulpmiddel worden, vooral voor het ter plaatse meten van het GABA-gehalte in landbouwproducten.

Ontwikkelingsvalidatie van de Huaxia ™ Platinum PCR-amplificatiekit: een 6-kleurige multiplex directe amplificatietest ontworpen voor Chinese referentiemonsters.

De Huaxia ™ Platinum Kit voor amplificatie met korte tandemherhaling (STR) is ontworpen om te voldoen aan de behoeften van de snelgroeiende Chinese forensische database. Deze PCR-multiplex maakt gelijktijdige versterking van de volgende autosomale loci mogelijk: D3S1358, vWA, D16S539, CSF1PO, TPOX, D8S1179, D21S11, D18S51, Penta E, D2S441, D19S433, TH01, FGA, D22S1045, D5S82018, D10S43 , D1S1656, D12S391, D2S1338, Penta D en de geslachtsidentificatiemarkeringen Yindel en AMEL. De Huaxia ™ Platinum Kit maakt directe amplificatie mogelijk van bloed- en buccale monsters die zijn opgeslagen op behandeld en onbehandeld papier, en beschikt over een geoptimaliseerd PCR-protocol dat de tijd tot resultaten oplevert in minder dan 45 minuten.

Ontwikkelingsvalidatietests volgden de SWGDAM-richtlijnen en toonden aan dat deze test reproduceerbare en nauwkeurige resultaten oplevert. Studies bij 798 individuen in 4 grote Chinese etnische groepen leverden zeer overeenstemmende resultaten op met andere commercieel verkrijgbare STR-genotyperingskits. De validatieresultaten tonen aan dat de Huaxia ™ Platinum Kit een robuust en betrouwbaar identificatiesysteem is voor forensische DNA-databasetoepassingen.

Evaluatie van de multiplex real-time PCR-assays RealStar malaria S&T PCR-kit 1.0 en FTD-malariadifferentiatie voor de differentiatie van Plasmodium-soorten in klinische monsters.

Twee commerciële PCR-testen werden beoordeeld in een retrospectieve studie om hun betrouwbaarheid te bepalen als instrumenten voor de differentiatie van Plasmodium-soorten in menselijk bloed. 1022 bloedmonsters van 817 patiënten met vermoedelijke of bevestigde malaria werden ingediend bij het Duitse nationale referentiecentrum voor tropische pathogenen werden onderworpen aan malariamicroscopie met behulp van dikke en dunne bloedfilms en aan een geslachtspecifieke malaria real-time PCR. Parasiet-positieve monsters werden geanalyseerd met RealStar Malaria S&T PCR Kit 1.0 (altona Diagnostics) en FTD Malaria Differentiation (Fast Track Diagnostics) multiplex real-time PCR-assays gericht op soortspecifiek Plasmodium-DNA. 247 van de 1022 bloedmonsters (24,2% ) positief getest op Plasmodium spp.

FAM-Phe-CMK FLISP™ Assay Kit
KF17315	Neuromics	100 Tests	EUR 695

FAM-Lue-CMK FLISP™ Assay Kit
KF17316	Neuromics	25 Tests	EUR 291

FAM-Spacer-Phe-CMK FLISP™ Assay Kit
KF17322	Neuromics	25 Tests	EUR 291

FAM-Spacer-Phe-CMK FLISP™ Assay Kit
KF17323	Neuromics	100 Tests	EUR 695

FAM-Phe-DAP Serine Protease Assay Kit
abx299013-25tests	Abbexa	25 tests	EUR 582
Shipped within 1 week.

SR-101-Leu-CMK FLISP™ Assay Kit
KF17321	Neuromics	100 Tests	EUR 695

FAM-Leu-CMK Serine Protease Assay Kit
abx299011-25tests	Abbexa	25 tests	EUR 566
Shipped within 1 week.

OPTIONAL GREEN FILTER (572NM)
GDBL-GREEN	CORNING	1/pk	EUR 1052
Description: Lab Equipment; Axygen Branded EQ

Polycaspase Assay Kit, green
KF17200	Neuromics	25 Tests	EUR 304

SR-101-Phe-CMK FLISP™ Assay Kit
KF17318	Neuromics	25 Tests	EUR 291

SR-101-Phe-CMK FLISP™ Assay Kit
KF17319	Neuromics	100 Tests	EUR 695

Malachite Green Phosphate Assay Kit
abx298878-100Assays	Abbexa	100 Assays	EUR 378
Shipped within 5-10 working days.

Caspase 1 Assay Kit, green
KF17201	Neuromics	25 Tests	EUR 325

Caspase 2 Assay Kit, green
KF17202	Neuromics	25 Tests	EUR 304

Caspase 6 Assay Kit, green
KF17204	Neuromics	25 Tests	EUR 304

Caspase 8 Assay Kit, green
KF17205	Neuromics	25 Tests	EUR 304

Caspase 9 Assay Kit, green
KF17206	Neuromics	25 Tests	EUR 304

Caspase 10 Assay Kit, green
KF17207	Neuromics	25 Tests	EUR 304

Caspase 13 Assay Kit, green
KF17208	Neuromics	25 Tests	EUR 304

Malachite Green Phosphate Assay Kit
POMG-25H	BioAssay Systems	2500	EUR 275
Description: High-throµghput phosphate assay using malachite green method at 620nm. Kit size: 2500 tests. Detection limit: 0.02 µM. Shelf life: 12 months. Shipping: ambient temp; storage: 4°C.

Malachite Green Phosphate Assay Kit
Z5030012	Biochain	2,500 assays	EUR 342
Description: Premade ready to use kits will always come in handy. Get your experiment done right form the first try by using a validated kit with perfectly balanced reagents proportions and compatibility and by following a clear protocol.

FAM-Phe-CMK Serine Protease Assay Kit
abx299010-25tests	Abbexa	25 tests	EUR 566
Shipped within 1 week.

FAM-cAMP PDE IV substrate *Green Fluorescence*
13602	AAT Bioquest	0.5 umol	EUR 306
R-phrase: R20, R21, R22 H-Phrase: H303, H313, H333 Symbol for dangerous compounds: Xn UNSPEC Code: 12352200

FAM-cGMP PDE V substrate *Green Fluorescence*
13604	AAT Bioquest	0.5 umol	EUR 306
R-phrase: R20, R21, R22 H-Phrase: H303, H313, H333 Symbol for dangerous compounds: Xn UNSPEC Code: 12352200

Caspase 3 & 7 Assay Kit, green
KF17203	Neuromics	25 Tests	EUR 304

EZCell? Phagocytosis Assay Kit (Green Zymosan)
K397-100	Biovision		EUR 430

EZCell? Phagocytosis Assay Kit (Green E. coli)
K963-100	Biovision		EUR 430

OxiSelect Intracellular ROS Assay Kit (Green Fluorescence)
STA-342	Cell Biolabs	96 assays	EUR 635
Description: The OxiSelect ROS Assay Kit is a cell-based assay for measuring hydroxyl, peroxyl, and other reactive oxygen species activity within a cell. The assay employs the cell-permeable fluorogenic probe DCFH-DA, which diffuses into cells and is deacetylcated by cellular esterases into the non-fluorescent DCFH (Figure 1). In the presence of ROS, DCFH is rapidly oxidized to highly fluorescent DCF. Fluorescence is read on a standard fluorometric plate reader.

OxiSelect Intracellular ROS Assay Kit (Green Fluorescence)
STA-342-5	Cell Biolabs	5 x 96 assays	EUR 2549
Description: The OxiSelect ROS Assay Kit is a cell-based assay for measuring hydroxyl, peroxyl, and other reactive oxygen species activity within a cell. The assay employs the cell-permeable fluorogenic probe DCFH-DA, which diffuses into cells and is deacetylcated by cellular esterases into the non-fluorescent DCFH (Figure 1). In the presence of ROS, DCFH is rapidly oxidized to highly fluorescent DCF. Fluorescence is read on a standard fluorometric plate reader.

OxiSelect Cellular Antioxidant Assay Kit (Green Fluorescence)
STA-349	Cell Biolabs	192 assays	EUR 537
Description: The OxiSelect Cellular Antioxidant Assay Kit is a cell-based assay for measuring the activity of an exogenous antioxidant compound within adherent cells.  Cells are first cultured in a 96-well black fluorescence cell culture plate until confluent. Then the cells are pre-incubated with a cell-permeable DCFH-DA fluorescence probe dye and the bioflavonoid Quercetin, or the antioxidant sample being tested.  After a brief incubation, the cells are washed, and the reaction started by adding the Free Radical Initiator.  The Free Radical Initiator creates free radicals that convert the probe to highly fluorescent DCF.  The Quercetin inhibits the formation of free radicals, and thus DCF formation, in a concentration dependent manner.

Mca-Pro-Leu-Gly-Leu-Dap(Dnp)-Ala-Arg-NH2
M-1895.0001	Bachem	1.0mg	EUR 321
Description: Sum Formula: C49H68N14O15; CAS# [140430-53-1] net

Mca-Pro-Leu-Gly-Leu-Dap(Dnp)-Ala-Arg-NH2
M-1895.0005	Bachem	5.0mg	EUR 1192
Description: Sum Formula: C49H68N14O15; CAS# [140430-53-1] net

Amplite™ Fluorimetric Acetylcholinesterase Assay Kit *Green Fluorescence*
11401	AAT Bioquest	200 Tests	EUR 219
R-phrase: R20, R21, R22 H-Phrase: H303, H313, H333 Symbol for dangerous compounds: Xn UNSPEC Code: 12171501

Dap/ Rat Dap ELISA Kit
ELI-31052r	Lifescience Market	96 Tests	EUR 886

Abz-Lys-Pro-Leu-Gly-Leu-Dap(Dnp)-Ala-Arg-NH2
H-2638.0001	Bachem	1.0mg	EUR 236
Description: Sum Formula: C50H77N17O13; CAS# [290362-09-3] net

Abz-Lys-Pro-Leu-Gly-Leu-Dap(Dnp)-Ala-Arg-NH2
H-2638.0005	Bachem	5.0mg	EUR 853
Description: Sum Formula: C50H77N17O13; CAS# [290362-09-3] net

Mca-Lys-Pro-Leu-Gly-Leu-Dap(Dnp)-Ala-Arg-NH2
M-2350.0001	Bachem	1.0mg	EUR 368
Description: Sum Formula: C55H80N16O16; CAS# [720710-69-0] net

Mca-Lys-Pro-Leu-Gly-Leu-Dap(Dnp)-Ala-Arg-NH2
M-2350.0005	Bachem	5.0mg	EUR 1385
Description: Sum Formula: C55H80N16O16; CAS# [720710-69-0] net

Mca-Pro-Leu-Gly-Leu-Glu-Glu-Ala-Dap(Dnp)-NH2
M-2670.0001	Bachem	1.0mg	EUR 334
Description: Sum Formula: C53H70N12O20; CAS# [891198-38-2] net

Mca-Pro-Leu-Gly-Leu-Glu-Glu-Ala-Dap(Dnp)-NH2
M-2670.0005	Bachem	5.0mg	EUR 1240
Description: Sum Formula: C53H70N12O20; CAS# [891198-38-2] net

Cell Meter™ Cell Viability Assay Kit *Green Fluorescence*
22786	AAT Bioquest	500 Tests	EUR 219
R-phrase: R20, R21, R22 H-Phrase: H303, H313, H333 Symbol for dangerous compounds: Xn UNSPEC Code: 12352200

Cell Meter™ TUNEL Apoptosis Assay Kit *Green Fluorescence*
22849	AAT Bioquest	50 Tests	EUR 306
R-phrase: R20, R21, R22 H-Phrase: H303, H313, H333 Symbol for dangerous compounds: Xn UNSPEC Code: 12352200

Amplite™ MMP-3 Activity Assay Kit *Green Fluorescence*
13512	AAT Bioquest	100 Tests	EUR 306
R-phrase: R20, R21, R22 H-Phrase: H303, H313, H333 Symbol for dangerous compounds: Xn UNSPEC Code: 12352200

Amplite™ Fluorimetric HDAC Activity Assay Kit *Green Fluorescence*
13601	AAT Bioquest	200 Tests	EUR 219
R-phrase: R20, R21, R22 H-Phrase: H303, H313, H333 Symbol for dangerous compounds: Xn UNSPEC Code: 12352200

Amplite™ Fluorimetric Alkaline Phosphatase Assay Kit *Green Fluorescence*
11953	AAT Bioquest	500 Tests	EUR 219
R-phrase: R20, R21, R22 H-Phrase: H303, H313, H333 Symbol for dangerous compounds: Xn UNSPEC Code: 12171501

Amplite™ Fluorimetric Beta-Galactosidase Assay Kit *Green Fluorescence*
12601	AAT Bioquest	500 Tests	EUR 306
R-phrase: R20, R21, R22 H-Phrase: H303, H313, H333 Symbol for dangerous compounds: Xn UNSPEC Code: 12352200

EZClick? Myristoylated Protein Assay Kit (FACS/Microscopy), Green Fluorescence
K497-100	Biovision		EUR 490

EZClick? Palmitoylated Protein Assay Kit (FACS/Microscopy), Green Fluorescence
K452-100	Biovision		EUR 490

EZClick? Stearoylated Protein Assay Kit (FACS/Microscopy), Green Fluorescence
K453-100	Biovision		EUR 490

OxiSelect Intracellular ROS Assay Kit (Green Fluorescence), Trial Size
STA-342-T	Cell Biolabs	20 assays	EUR 345
Description: The OxiSelect ROS Assay Kit is a cell-based assay for measuring hydroxyl, peroxyl, and other reactive oxygen species activity within a cell. The assay employs the cell-permeable fluorogenic probe DCFH-DA, which diffuses into cells and is deacetylcated by cellular esterases into the non-fluorescent DCFH (Figure 1). In the presence of ROS, DCFH is rapidly oxidized to highly fluorescent DCF. Fluorescence is read on a standard fluorometric plate reader.

OxiSelect In Vitro ROS/RNS Assay Kit (Green Fluorescence)
STA-347	Cell Biolabs	96 assays	EUR 612
Description: The OxiSelect In Vitro ROS/RNS Assay provides a sensitive method to detect total reactive oxygen species (ROS) plus reactive nitrogen species (RNS) in a wide variety of sample types. This assay employs a proprietary fluorogenic probe, DCFH-DiOxyQ; the probe is primed with a dequenching reagent to the highly reactive DCFH form. In the presence of ROS and RNS, the DCFH is rapidly oxidized to the highly fluorescent DCF.

OxiSelect In Vitro ROS/RNS Assay Kit (Green Fluorescence)
STA-347-5	Cell Biolabs	5 x 96 assays	EUR 2428
Description: The OxiSelect In Vitro ROS/RNS Assay provides a sensitive method to detect total reactive oxygen species (ROS) plus reactive nitrogen species (RNS) in a wide variety of sample types. This assay employs a proprietary fluorogenic probe, DCFH-DiOxyQ; the probe is primed with a dequenching reagent to the highly reactive DCFH form. In the presence of ROS and RNS, the DCFH is rapidly oxidized to the highly fluorescent DCF.

Mca-Pro-Lys-Pro-Leu-Ala-Leu-Dap(Dnp)-Ala-Arg-NH2
M-2225.0001	Bachem	1.0mg	EUR 371
Description: Sum Formula: C61H89N17O17; CAS# [396717-35-4] net

Mca-Pro-Lys-Pro-Leu-Ala-Leu-Dap(Dnp)-Ala-Arg-NH2
M-2225.0005	Bachem	5.0mg	EUR 1321
Description: Sum Formula: C61H89N17O17; CAS# [396717-35-4] net

N-Me-Abz-Lys-Pro-Leu-Gly-Leu-Dap(Dnp)-Ala-Arg-NH2
M-2145.0001	Bachem	1.0mg	EUR 441
Description: Sum Formula: C51H79N17O13; CAS# [396716-07-7] net

N-Me-Abz-Lys-Pro-Leu-Gly-Leu-Dap(Dnp)-Ala-Arg-NH2
M-2145.0005	Bachem	5.0mg	EUR 1675
Description: Sum Formula: C51H79N17O13; CAS# [396716-07-7] net

Cell Navigator™ Fluorimetric Lipid Droplet Assay Kit *Green Fluorescence*
22730	AAT Bioquest	200 Tests	EUR 219
R-phrase: R20, R21, R22 H-Phrase: H303, H313, H333 Symbol for dangerous compounds: Xn UNSPEC Code: 12352200

Amplite™ Fluorimetric Proteasome 20S Activity Assay Kit *Green Fluorescence*
13456	AAT Bioquest	100 tests	EUR 306
R-phrase: R20, R21, R22 H-Phrase: H303, H313, H333 Symbol for dangerous compounds: Xn UNSPEC Code: 12352200

Amplite™ Universal Fluorimetric Protease Activity Assay Kit *Green Fluorescence*
13500	AAT Bioquest	500 Tests	EUR 219
R-phrase: R20, R21, R22 H-Phrase: H303, H313, H333 Symbol for dangerous compounds: Xn UNSPEC Code: 12352200

Amplite™ Fluorimetric Caspase 3/7 Assay Kit *Green Fluorescence*
13503	AAT Bioquest	500 Tests	EUR 306
R-phrase: R20, R21, R22 H-Phrase: H303, H313, H333 Symbol for dangerous compounds: Xn UNSPEC Code: 12352200

Amplite™ Universal Fluorimetric MMP Activity Assay Kit *Green Fluorescence*
13510	AAT Bioquest	100 Tests	EUR 306
R-phrase: R20, R21, R22 H-Phrase: H303, H313, H333 Symbol for dangerous compounds: Xn UNSPEC Code: 12352200

Cell Meter™ Fluorimetric Intracellular Peroxynitrite Assay Kit *Green Fluorescence*
16315	AAT Bioquest	100 Tests	EUR 350
R-phrase: R20, R21, R22 H-Phrase: H303, H313, H333 Symbol for dangerous compounds: Xn UNSPEC Code: 12352200

Amplite™ Fluorimetric Total Thiol Quantitation Assay Kit *Green Fluorescence*
5524	AAT Bioquest	200 Tests	EUR 219
R-phrase: R20, R21, R22 H-Phrase: H303, H313, H333 Symbol for dangerous compounds: Xn UNSPEC Code: 12352200

EZClick? Global Protein Synthesis Assay Kit (FACS/Microscopy), Green Fluorescence
K459-100	Biovision		EUR 550

5-FAM
20-abx095073	Abbexa	EUR 523.00 EUR 370.00 EUR 1274.00	1 g 500 mg 5 g
Shipped within 5-10 working days.

6-FAM
HY-66021	MedChemExpress	500mg	EUR 312

5-FAM
HY-66022	MedChemExpress	10mM/1mL	EUR 126

Cell Meter™ Caspase 8 Activity Apoptosis Assay Kit *Green Fluorescence*
22798	AAT Bioquest	200 Tests	EUR 219
R-phrase: R20, R21, R22 H-Phrase: H303, H313, H333 Symbol for dangerous compounds: Xn UNSPEC Code: 12352200

Cell Meter™ Caspase 9 Activity Apoptosis Assay Kit *Green Fluorescence*
22799	AAT Bioquest	200 Tests	EUR 306
R-phrase: R20, R21, R22 H-Phrase: H303, H313, H333 Symbol for dangerous compounds: Xn UNSPEC Code: 12352200

Cell Meter™ Intracellular Fluorimetric Hydrogen Peroxide Assay Kit *Green Fluorescence*
11503	AAT Bioquest	200 Tests	EUR 263
R-phrase: R20, R21, R22 H-Phrase: H303, H313, H333 Symbol for dangerous compounds: Xn UNSPEC Code: 12171501

Cell Meter™ Fluorimetric Mitochondrial Superoxide Activity Assay Kit *Green Fluorescence*
16060	AAT Bioquest	200 Tests	EUR 306
R-phrase: R20, R21, R22 H-Phrase: H303, H313, H333 Symbol for dangerous compounds: Xn UNSPEC Code: 12352200

Amplite™ Rapid Fluorimetric Total Thiol Quantitation Assay Kit *Green Fluorescence*
5528	AAT Bioquest	200 Tests	EUR 219
R-phrase: R20, R21, R22 H-Phrase: H303, H313, H333 Symbol for dangerous compounds: Xn UNSPEC Code: 12352200

EZClick? O-GalNAc Modified Glycoprotein Assay Kit (FACS/Microscopy, Green Fluorescence)
K560-100	Biovision		EUR 490

EZClickTM Fucose (FucAz) Modified Glycoprotein Assay Kit (FACS/Microscopy, Green Fluorescence)
K592-100	Biovision		EUR 490

EZClick? O-GlcNAc Modified Glycoprotein Assay Kit (FACS/Microscopy, Green Fluorescence)
K714-100	Biovision		EUR 512

OxiSelect In Vitro ROS/RNS Assay Kit (Green Fluorescence), Trial Size
STA-347-T	Cell Biolabs	20 assays	EUR 334
Description: The OxiSelect In Vitro ROS/RNS Assay provides a sensitive method to detect total reactive oxygen species (ROS) plus reactive nitrogen species (RNS) in a wide variety of sample types. This assay employs a proprietary fluorogenic probe, DCFH-DiOxyQ; the probe is primed with a dequenching reagent to the highly reactive DCFH form. In the presence of ROS and RNS, the DCFH is rapidly oxidized to the highly fluorescent DCF.

Mca-Pro-Leu-Ala-Nva-Dap(Dnp)-Ala-Arg-NH2
M-2520.0001	Bachem	1.0mg	EUR 321
Description: Sum Formula: C49H68N14O15; CAS# [256394-92-0] net

Mca-Pro-Leu-Ala-Nva-Dap(Dnp)-Ala-Arg-NH2
M-2520.0005	Bachem	5.0mg	EUR 1192
Description: Sum Formula: C49H68N14O15; CAS# [256394-92-0] net

Branched Chain Amino Acid (Leu/Ile/Val) Colorimetric Assay Kit
K564-100	Biovision		EUR 539

Branched Chain Amino Acid (Leu/Ile/Val) Colorimetric Assay Kit
K2085-100	ApexBio	100 assays	EUR 529

DAP antibody
70R-16735	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal DAP antibody

DAP Antibody
35710-100ul	SAB	100ul	EUR 252

DAP antibody
38736-100ul	SAB	100ul	EUR 252

DAP Antibody
43505-100ul	SAB	100ul	EUR 252

DAP Antibody
DF7628	Affbiotech	200ul	EUR 304
Description: DAP Antibody detects endogenous levels of total DAP.

DAP Antibody
1-CSB-PA262326	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against DAP. Recognizes DAP from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200

DAP Antibody
1-CSB-PA170450	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against DAP. Recognizes DAP from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:25-1:100

DAP Antibody
1-CSB-PA006496GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20oC, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against DAP. Recognizes DAP from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA

DAP antibody
70R-32429	Fitzgerald	100 ug	EUR 327
Description: Rabbit polyclonal DAP antibody

DAP Antibody
1-CSB-PA01034A0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DAP. Recognizes DAP from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:50-1:200

DAP Antibody
1-CSB-PA007640	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against DAP. Recognizes DAP from Human, Mouse. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC:1/100-1/300.ELISA:1/40000

DAP siRNA
20-abx901410	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

DAP siRNA
20-abx913570	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

DAP siRNA
20-abx913571	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

DAP Antibody
ABD7628	Lifescience Market	100 ug	EUR 438

Cell Meter™ Live Cell Caspase 1 Binding Assay Kit *Green Fluorescence*
20108	AAT Bioquest	25 Tests	EUR 306
R-phrase: R20, R21, R22 H-Phrase: H303, H313, H333 Symbol for dangerous compounds: Xn UNSPEC Code: 12352200

Cell Meter™ Live Cell Caspase 2 Binding Assay Kit *Green Fluorescence*
20111	AAT Bioquest	25 Tests	EUR 306
R-phrase: R20, R21, R22 H-Phrase: H303, H313, H333 Symbol for dangerous compounds: Xn UNSPEC Code: 12352200

Cell Meter™ Live Cell Caspase 8 Binding Assay Kit *Green Fluorescence*
20115	AAT Bioquest	25 Tests	EUR 306
R-phrase: R20, R21, R22 H-Phrase: H303, H313, H333 Symbol for dangerous compounds: Xn UNSPEC Code: 12352200

Cell Meter™ Live Cell Caspase 9 Binding Assay Kit *Green Fluorescence*
20117	AAT Bioquest	25 Tests	EUR 306
R-phrase: R20, R21, R22 H-Phrase: H303, H313, H333 Symbol for dangerous compounds: Xn UNSPEC Code: 12352200

Cell Meter™ Live Cell Caspase 13 Binding Assay Kit *Green Fluorescence*
20125	AAT Bioquest	25 Tests	EUR 306
R-phrase: R20, R21, R22 H-Phrase: H303, H313, H333 Symbol for dangerous compounds: Xn UNSPEC Code: 12352200

Live or Dead™ Cell Viability Assay Kit *Green/Red Dual Fluorescence*
22789	AAT Bioquest	200 Tests	EUR 219
R-phrase: R20, R21, R22 H-Phrase: H303, H313, H333 Symbol for dangerous compounds: Xn UNSPEC Code: 12352200

Cell Meter™ Caspase 3/7 Activity Apoptosis Assay Kit *Green Fluorescence*
22796	AAT Bioquest	200 Tests	EUR 219
R-phrase: R20, R21, R22 H-Phrase: H303, H313, H333 Symbol for dangerous compounds: Xn UNSPEC Code: 12352200

Cell Meter™ Fluorimetric Intracellular Total ROS Activity Assay Kit*Green Fluorescence*
22900	AAT Bioquest	200 Tests	EUR 219
R-phrase: R20, R21, R22 H-Phrase: H303, H313, H333 Symbol for dangerous compounds: Xn UNSPEC Code: 12352200

EZClick? Sialic Acid (ManAz) Modified Glycoprotein Assay Kit (FACS/Microscopy, Green Fluorescence)
K441-100	Biovision		EUR 490

FAM-LETD-FMK
13416	AAT Bioquest	100 ug	EUR 263
R-phrase: R20, R21, R22 H-Phrase: H303, H313, H333 Symbol for dangerous compounds: Xn UNSPEC Code: 12352200

5-FAM Alkyne
951	AAT Bioquest	100 mg	EUR 702
R-phrase: R20, R21, R22 H-Phrase: H303, H313, H333 Symbol for dangerous compounds: Xn UNSPEC Code: 12171501

6-FAM Azide
955	AAT Bioquest	100 mg	EUR 702
R-phrase: R20, R21, R22 H-Phrase: H303, H313, H333 Symbol for dangerous compounds: Xn UNSPEC Code: 12171501

6-FAM Alkyne
956	AAT Bioquest	100 mg	EUR 702
R-phrase: R20, R21, R22 H-Phrase: H303, H313, H333 Symbol for dangerous compounds: Xn UNSPEC Code: 12171501

5-FAM Azide
950	AAT Bioquest	100 mg	EUR 702
R-phrase: R20, R21, R22 H-Phrase: H303, H313, H333 Symbol for dangerous compounds: Xn UNSPEC Code: 12171501

3?-FAM CPG
AHP-CH-FAM0103	Allele Biotech	100 mg	Ask for price
Product line: Oligo Modification CPG Brand:

3?-FAM CPG
AHP-CH-FAM1003	Allele Biotech	1000 mg	Ask for price
Product line: Oligo Modification CPG Brand:

6 FAM SE
A8771-10	ApexBio	10 mg	EUR 174
Description: 6-FAM SE, also known as 6-Carboxyfluorescein N-hydroxysuccinimide ester or 6-Carboxyfluorescein N-succinimidyl ester, is an isomer of carboxyfluorescein and amine-reactive succinimidyl ester carboxyfluorescein.

6 FAM SE
A8771-100	ApexBio	100 mg	EUR 731
Description: 6-FAM SE, also known as 6-Carboxyfluorescein N-hydroxysuccinimide ester or 6-Carboxyfluorescein N-succinimidyl ester, is an isomer of carboxyfluorescein and amine-reactive succinimidyl ester carboxyfluorescein.

6 FAM SE
A8771-5.1	ApexBio	10 mM (in 1mL DMSO)	EUR 199
Description: 6-FAM SE, also known as 6-Carboxyfluorescein N-hydroxysuccinimide ester or 6-Carboxyfluorescein N-succinimidyl ester, is an isomer of carboxyfluorescein and amine-reactive succinimidyl ester carboxyfluorescein.

6 FAM SE
A8771-50	ApexBio	50 mg	EUR 453
Description: 6-FAM SE, also known as 6-Carboxyfluorescein N-hydroxysuccinimide ester or 6-Carboxyfluorescein N-succinimidyl ester, is an isomer of carboxyfluorescein and amine-reactive succinimidyl ester carboxyfluorescein.

5-FAM SE
HY-15938	MedChemExpress	100mg	EUR 1207

6-FAM SE
HY-15939	MedChemExpress	100mg	EUR 612

5-FAM-Woodtide
H-7644.0001	Bachem	1.0mg	EUR 394
Description: Sum Formula: C89H133N21O26S; CAS# [1566528-51-5] net

Islr ELISA Kit| Mouse Immunoglobulin superfamily containing leu
EF015231	Lifescience Market	96 Tests	EUR 689

Frit Kit
FRIT-KIT	Next Advance	1each	EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Cell Meter™ Live Cell Caspase 3/7 Binding Assay Kit *Green Fluorescence*
20100	AAT Bioquest	25 Tests	EUR 306
R-phrase: R20, R21, R22 H-Phrase: H303, H313, H333 Symbol for dangerous compounds: Xn UNSPEC Code: 12352200

Cell Meter™ Phosphatidylserine Apoptosis Assay Kit *Green Fluorescence Optimized for Microplate Readers*
22791	AAT Bioquest	100 Tests	EUR 219
R-phrase: R20, R21, R22 H-Phrase: H303, H313, H333 Symbol for dangerous compounds: Xn UNSPEC Code: 12352200

Cell Meter™ Nuclear Apoptosis Assay Kit *Green Fluorescence Optimized for Flow Cytometry*
22811	AAT Bioquest	100 Tests	EUR 219
R-phrase: R20, R21, R22 H-Phrase: H303, H313, H333 Symbol for dangerous compounds: Xn UNSPEC Code: 12352200

Cell Meter™ Phosphatidylserine Apoptosis Assay Kit *Green Fluorescence Optimized for Flow Cytometry*
22831	AAT Bioquest	100 Tests	EUR 219
R-phrase: R20, R21, R22 H-Phrase: H303, H313, H333 Symbol for dangerous compounds: Xn UNSPEC Code: 12352200

Cell Meter™ Phosphatidylserine Apoptosis Assay Kit *Green Fluorescence Excited at 405 nm*
22836	AAT Bioquest	100 Tests	EUR 219
R-phrase: R20, R21, R22 H-Phrase: H303, H313, H333 Symbol for dangerous compounds: Xn UNSPEC Code: 12352200

Mca-Pro-Leu-Ala-Cys(Mob)-Trp-Ala-Arg-Dap(Dnp)-NH2
M-2510.0001	Bachem	1.0mg	EUR 708
Description: Sum Formula: C66H82N16O17S; CAS# [1926163-82-7] net

Mca-Pro-Leu-Ala-Cys(Mob)-Trp-Ala-Arg-Dap(Dnp)-NH2
M-2510.0005	Bachem	5.0mg	EUR 2739
Description: Sum Formula: C66H82N16O17S; CAS# [1926163-82-7] net

Column Packing Kit
PACK-KIT	Next Advance	1pack	EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

Malachite Green ELISA Kit
DEIA057	Creative Diagnostics	96T	EUR 1251
Description: The Malachite Green ELISA Kit is a direct competitive enzyme immunoassay for the quantitative analysis of Malachite green in fish and shrimp samples.

Green Lysis Kit 50
GREENE1	Next Advance	50pack	EUR 156
Description: Bead lysis kits for the homogenization of small, tough samples. Pack of 50, 1.5mL Eppendorf Safe-Lock tubes prefilled with beads.

Green Lysis Kit 250
GREENE5	Next Advance	250pack	EUR 468
Description: Bead lysis kits for the homogenization of small, tough samples. Pack of 250, 1.5mL Eppendorf Safe-Lock tubes prefilled with beads.

FAM FLICAâ„¢ POLY CASPASE KIT (OKSA11268)
OKSA11268	Aviva Systems Biology	25 Tests	EUR 591
Description: Description of target: FAM FLICAâ„¢ POLY CASPASE KIT;Species reactivity: ;Application: FC, IF;Assay info: ;Sensitivity:

FAM FLICAâ„¢ POLY CASPASE KIT (OKSA11269)
OKSA11269	Aviva Systems Biology	100 Tests	EUR 1524
Description: Description of target: FAM FLICAâ„¢ POLY CASPASE KIT;Species reactivity: ;Application: FC, IF;Assay info: ;Sensitivity:

FAM FLICACASPASE-3/7 KIT (OKSA11270)
OKSA11270	Aviva Systems Biology	25 Tests	EUR 591
Description: Description of target: Caspase FLICA™ kits measure apoptosis by detecting active caspases in whole, living cells. These kits do not work by using antibodies or as an ELISA. Instead, their methodology is based on a unique cell-permeable and non-cytotoxic reagent called the Fluorochrome Inhibitor of Caspases (FLICA). The FLICA™ reagent contains a caspase inhibitor sequence linked to a green (Carboxyfluorescein, FAM) fluorescent probe. The Caspase FLICA™ Kits are suitable for cells in suspension, adherent cells, thin tissue sections (but not fixed or paraffin-embedded cells) from many species including mammalian, insect and yeast. Different cell types, e.g. HeLa, primary neurons, macrophages and lymphocytes have also been successfully studied with these kits. This kit can be used with a flow cytometer, fluorescence microscope or a fluorescence plate reader using black microtitre plates. ;Species reactivity: ;Application: FC, IF;Assay info: ;Sensitivity:

FAM FLICAâ„¢ CASPASE-6 KIT (OKSA11272)
OKSA11272	Aviva Systems Biology	25 Tests	EUR 598
Description: Description of target: FAM FLICAâ„¢ CASPASE-6 KIT;Species reactivity: ;Application: FC, IF;Assay info: ;Sensitivity:

FAM FLICAâ„¢ CASPASE-6 KIT (OKSA11273)
OKSA11273	Aviva Systems Biology	100 Tests	EUR 1550
Description: Description of target: FAM FLICAâ„¢ CASPASE-6 KIT;Species reactivity: ;Application: FC, IF;Assay info: ;Sensitivity:

FAM FLICA CASPASE-1 KIT (OKSA11274)
OKSA11274	Aviva Systems Biology	25 Tests	EUR 591
Description: Description of target: FAM FLICAâ„¢ CASPASE-1 KIT;Species reactivity: ;Application: FC, IF;Assay info: ;Sensitivity:

FAM FLICA CASPASE-1 KIT (OKSA11275)
OKSA11275	Aviva Systems Biology	100 Tests	EUR 1523
Description: Description of target: The FAM FLICATM Capase 1 kit uses a target sequence (YVAD) sandwiched between a green fluorescent label, FAM, and FMK to make a quick and flexible method to analyze active capases in apoptotic cells. These kits measure apoptosis by detecting active caspases in whole, living cells. They don't work by using antibodies or an ELISA. Instead, their methodology is based a unique cell-permeable and non-cytotoxic reagent called Fluorochrome Inhibitor of Caspases. These kits are suitable for cells in suspension, adherent cells, thin tissue sections (but not fixed or paraffin-embedded cells) from many species including mammalian, insect, and yeast. Different cell types, e.g. HeLa, primary neurons, macrophages and lymphocytes have also been successfully studied with these kits. ;Species reactivity: Human;Application: FC, IF;Assay info: ;Sensitivity:

FAM FLICAâ„¢ CASPASE-8 KIT (OKSA11276)
OKSA11276	Aviva Systems Biology	25 Tests	EUR 591
Description: Description of target: FAM FLICAâ„¢ CASPASE-8 KIT;Species reactivity: ;Application: FC, IF;Assay info: ;Sensitivity:

FAM FLICAâ„¢ CASPASE-8 KIT (OKSA11277)
OKSA11277	Aviva Systems Biology	100 Tests	EUR 1524
Description: Description of target: FAM FLICAâ„¢ CASPASE-8 KIT;Species reactivity: ;Application: FC, IF;Assay info: ;Sensitivity:

FAM FLICAâ„¢ CASPASE-9 KIT (OKSA11278)
OKSA11278	Aviva Systems Biology	25 Tests	EUR 591
Description: Description of target: FAM FLICAâ„¢ CASPASE-9 KIT;Species reactivity: ;Application: FC, IF;Assay info: ;Sensitivity:

FAM FLICAâ„¢ CASPASE-9 KIT (OKSA11279)
OKSA11279	Aviva Systems Biology	100 Tests	EUR 1524
Description: Description of target: FAM FLICAâ„¢ CASPASE-9 KIT;Species reactivity: ;Application: FC, IF;Assay info: ;Sensitivity:

FAM FLICAâ„¢ CASPASE-2 KIT (OKSA11282)
OKSA11282	Aviva Systems Biology	25 Tests	EUR 557
Description: Description of target: FAM FLICAâ„¢ CASPASE-2 KIT;Species reactivity: ;Application: FC, IF;Assay info: ;Sensitivity:

FAM FLICA CASPASE-2 KIT (OKSA11283)
OKSA11283	Aviva Systems Biology	100 Tests	EUR 1328
Description: Description of target: FAM FLICAâ„¢ CASPASE-2 KIT;Species reactivity: ;Application: FC, IF;Assay info: ;Sensitivity:

FAM FLICA CASPASE-10 KIT (OKSA11285)
OKSA11285	Aviva Systems Biology	100 Tests	EUR 1563
Description: Description of target: FAM FLICAâ„¢ CASPASE-10 KIT;Species reactivity: ;Application: FC, IF;Assay info: ;Sensitivity:

PCR Mycoplasma Detection Kit
M034-Kit	TOKU-E	Kit	EUR 266

Boc-Dap-OH
5-04779	CHI Scientific	5g	Ask for price

Boc-Dap-OH
5-04780	CHI Scientific	25g	Ask for price

Fmoc-Dap-OH
5-04797	CHI Scientific	5g	Ask for price

Fmoc-Dap-OH
5-04798	CHI Scientific	25g	Ask for price

Fmoc-Dap-OH
B-2385.0001	Bachem	1.0g	EUR 151
Description: Sum Formula: C18H18N2O4; CAS# [181954-34-7]

Fmoc-Dap-OH
B-2385.0005	Bachem	5.0g	EUR 515
Description: Sum Formula: C18H18N2O4; CAS# [181954-34-7]

Fmoc-Dap-OH
B-2385.0025	Bachem	25.0g	EUR 1965
Description: Sum Formula: C18H18N2O4; CAS# [181954-34-7]

DAP Blocking Peptide
DF7628-BP	Affbiotech	1mg	EUR 195

Boc-Dap-OH
A-3220.0001	Bachem	1.0g	EUR 126
Description: Sum Formula: C8H16N2O4; CAS# [73259-81-1]

Boc-Dap-OH
A-3220.0005	Bachem	5.0g	EUR 418
Description: Sum Formula: C8H16N2O4; CAS# [73259-81-1]

Boc-Dap-OH
A-3220.0025	Bachem	25.0g	EUR 1578
Description: Sum Formula: C8H16N2O4; CAS# [73259-81-1]

Boc-Dap-OtBu
A-4715.0001	Bachem	1.0g	EUR 309
Description: Sum Formula: C12H24N2O4; CAS# [77215-54-4] net

Boc-Dap-OtBu
A-4715.0005	Bachem	5.0g	EUR 1143
Description: Sum Formula: C12H24N2O4; CAS# [77215-54-4] net

DAP-3 Antibody
20-abx141935	Abbexa	EUR 370.00 EUR 606.00 EUR 300.00	100 ul 200 ul 50 ul
Shipped within 5-10 working days.

Z-Dap-OH
C-3315.0005	Bachem	5.0g	EUR 236
Description: Sum Formula: C11H14N2O4; CAS# [35761-26-3]

Z-Dap-OH
C-3315.0025	Bachem	25.0g	EUR 841
Description: Sum Formula: C11H14N2O4; CAS# [35761-26-3]

DAP Conjugated Antibody
C35710	SAB	100ul	EUR 397

Polyclonal DAP Antibody
APR06825G	Leading Biology	0.1 mg	EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human DAP . This antibody is tested and proven to work in the following applications:

DAP cloning plasmid
CSB-CL006496HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 309 Sequence: atgtcttcgcctcccgaagggaaactagagactaaagctggacacccgcccgccgtgaaagctggtggaatgcgaattgtgcagaaacacccacatacaggagacaccaaagaagagaaagacaaggatgaccaggaatgggaaagccccagtccacctaaacccactgtgttcat Show more
Description: A cloning plasmid for the DAP gene.

DAP Rabbit pAb
A6150-100ul	Abclonal	100 ul	EUR 308

De twee multiplex-assays vertoonden min of meer vergelijkbare prestatiekenmerken en leverden concordante soortinformatie op in 98,9% van de monsters die positief waren door malariamicroscopie en in 95,1% (RealStar) en 96,8% (FTD) van de monsters die positief waren door genus-specifieke PCR. In vergelijking met FTD onthulde RealStar een licht verminderde gevoeligheid voor submicroscopische, laag-niveau P. falciparum-infecties, terwijl FTD P. knowlesi niet kon detecteren. De twee commerciële malaria PCR-testen die zijn beoordeeld, zijn geschikt voor het onderscheiden van Plasmodium-soorten in klinische monsters en kunnen aanvullende informatie bij microscopisch onzekere bevindingen.